Sequence ID | >WENV170965932 |
Genome ID | MTEV01010427 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 2799 |
End posion on genome | 2883 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctttcgtgct |
tRNA gene sequence |
GCGAACGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGAGAGGTGTGAG |
Downstream region at tRNA end position |
gagcatgaaa |
Secondary structure (Cloverleaf model) | >WENV170965932 Leu TAG t ACCA gagcatgaaa G - C C - G G - C A - T A - T C - G G - C T G T C T C T C A T A A G | | | | | G T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCGAGAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |