Sequence ID | >WENV170965935 |
Genome ID | MTEV01010486 |
Phylum/Class | [MTEV] soil metagenome; soil bioaugmentation with soil previously exposed to atrazine |
Species | |
Start position on genome | 2146 |
End posion on genome | 2056 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gcgccaatat |
tRNA gene sequence |
GGAAGGTTGTCAGAGCGGTTTATTGTGCCTGTTTGCTAAATAGGTGTACGTCCTTAACGT |
Downstream region at tRNA end position |
aaatatgggg |
Secondary structure (Cloverleaf model) | >WENV170965935 Ser GCT t GCCA aaatatgggg G - C G - C A - T A - T G - C G - C T - A T A T T G T C C A C G A G | | | | | G G G A C T A C A G G C G + | | T T T T T G T T T A G TGTACGTCCTTAACGTACC C - G C - G T - A G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |