The detailed information of tRNA gene sequence


Sequence ID>WENV170970390
Genome IDMTKW01067045
Search identical group
Phylum/Class[MTKW] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant
Species
Start position on genome 4993
End posion on genome 4920
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
attgatcgtc
tRNA gene sequence
GGGCTCGTAGCTCAGCTGGCTAGAGCGCACGCCTGATAAGCGTGAGGTCGGAAGTTCAAG
TCTTCCCGGGCCCAttt
Downstream region at tRNA end position
tcgattgaca
Secondary structure (Cloverleaf model)
>WENV170970390	Ile	GAT
                   c      Attt tcgattgaca
                     G - C
                     G - C
                     G - C
                     C - G
                     T + G
                     C - G
                     G - C          T G
                    T     C C T T C     A
      C G A        A      | | | | |     A
    T       C T C G       G G A A G     C
    G       | | | |                 T T
    G       G A G C
      C T A        G     AGGTC
                    C - G
                    A - T
                    C - G
                    G - C
                    C - G
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK