The detailed information of tRNA gene sequence


Sequence ID>WENV170973400
Genome IDMTKY01035912
Search identical group
Phylum/Class[MTKY] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant
Species
Start position on genome 1435
End posion on genome 1360
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
nnnnnnnatg
tRNA gene sequence
GTGGCTGTAGTTCAGTTGGTAGAGCACCAGGTTGTGATCCTGGCTGTCGCGGGTTCGAGT
CCCGTCAGCCACCCCG
Downstream region at tRNA end position
acgcgcaggg
Secondary structure (Cloverleaf model)
>WENV170973400	His	GTG
                   g      CCCG acgcgcaggg
                     G - C
                     T - A
                     G - C
                     G - C
                     C - G
                     T - A
                     G - C          T G
                    T     T G C C C     A
      T G A        A      + | | | |     G
    T       C T T G       G C G G G     C
    G       | | + |                 T T
    G       G A G C
      T A          A     CTGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       T
                  T       A
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK