| Sequence ID | >WENV170978359 |
| Genome ID | MTKZ01048411 |
| Phylum/Class | [MTKZ] anaerobic digester metagenome; anaerobic digester fed with sludge from wastewater treatment plant |
| Species | |
| Start position on genome | 270 |
| End posion on genome | 198 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
ctattcaatc |
| tRNA gene sequence |
AGTCCCGTGGGGTAGAGGTCAATCCTGAGGGCCTTTGGAGCCCGCGACGGCGGTTCGAAT |
| Downstream region at tRNA end position |
agccatatcc |
| Secondary structure (Cloverleaf model) | >WENV170978359 Gln TTG
c Atgg agccatatcc
A - T
G - C
T - A
C - G
C - G
C - G
G - C T A
T C C G C C A
A G A G | | | | | G
G T G G G G G C G G C
G | | + T T
T T C C T
C A A G CGAC
A G
G - C
G - C
G - C
C - G
C A
T G
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |