Sequence ID | >WENV171002442 |
Genome ID | NHNJ01043506 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 186 |
End posion on genome | 273 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cttattattt |
tRNA gene sequence |
GCGGACGTGGCGGAACTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGATATAATCCTGT |
Downstream region at tRNA end position |
gatttaaaat |
Secondary structure (Cloverleaf model) | >WENV171002442 Leu GAG t ACCA gatttaaaat G - C C - G G - C G - C A - T C - G G - C T G T T C T T C A C A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGATATAATCCTGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |