Sequence ID | >WENV171002552 |
Genome ID | NHNJ01084516 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 1129 |
End posion on genome | 1217 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttcagccacT |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCGAAGGCGCAGCACTGGAAATGCTGTATAGGGGCAACTCTA |
Downstream region at tRNA end position |
gctaacgctt |
Secondary structure (Cloverleaf model) | >WENV171002552 Ser GGA T GTta gctaacgctt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATAGGGGCAACTCTATC C - G A - T G - C C - G A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |