Sequence ID | >WENV171002600 |
Genome ID | NHNJ01093907 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 376 |
End posion on genome | 288 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tacctttttt |
tRNA gene sequence |
GGAGGGATGGCCGAGCGGACGAAGGCGATAGTCTTGAAAACTATTGTATGTATTCCATAC |
Downstream region at tRNA end position |
gcctggagag |
Secondary structure (Cloverleaf model) | >WENV171002600 Ser TGA t GCAA gcctggagag G - C G - C A - T G - C G - C G - C A - T T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T A A G G C C G A G TGTATGTATTCCATACC A - T T - A A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |