Sequence ID | >WENV171002601 |
Genome ID | NHNJ01093907 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 283 |
End posion on genome | 192 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ccgcaagcct |
tRNA gene sequence |
GGAGAGGTGGCTGAGCGGTCTAAAGCGCTCGCCTGCTAAGCGAGTGGGGGATGAAAGTCC |
Downstream region at tRNA end position |
tgcgcctgta |
Secondary structure (Cloverleaf model) | >WENV171002601 Ser GCT t GCCA tgcgcctgta G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C G A G | | | | | A G G T C G G A G G G C G | | | T T T A A G C C T A G TGGGGGATGAAAGTCCCCTC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |