Sequence ID | >WENV171002610 |
Genome ID | NHNJ01099999 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 228 |
End posion on genome | 319 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tggtaaaaat |
tRNA gene sequence |
GGAAGAGTGGGTGAGCGGTTGAAACCAGTTGGTTGCTAACTAACCGTACGAGTAACATCG |
Downstream region at tRNA end position |
aaaattagtt |
Secondary structure (Cloverleaf model) | >WENV171002610 Ser GCT t GCCA aaaattagtt G - C G - C A - T A - T G - C A - T G - C T A T C T C T C A C G A G | | | | | G G G T G G G A G A G C G | | | T T T A A C C T G A A CGTACGAGTAACATCGTACC G - C T - A T - A G + T G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |