Sequence ID | >WENV171002672 |
Genome ID | NHNJ01131345 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 211 |
End posion on genome | 124 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aaaacaaacn |
tRNA gene sequence |
AGAGAGGTGGCCGAGTGGCTTAAGGCGCACGCTTGGAAAGCGTGTATACGGCAACGTATC |
Downstream region at tRNA end position |
ggttttacca |
Secondary structure (Cloverleaf model) | >WENV171002672 Ser GGA n GCAA ggttttacca A - T G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T C A G G C T T A G TATACGGCAACGTATC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |