Sequence ID | >WENV171002754 |
Genome ID | NHNJ01148278 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 727 |
End posion on genome | 815 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ttcagccacT |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTCGAAGGCGCAGCACTGGAAATGCTGTATAGGGGCAACTCTA |
Downstream region at tRNA end position |
gctaacgcta |
Secondary structure (Cloverleaf model) | >WENV171002754 Ser GGA T GTta gctaacgcta G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATAGGGGCAACTCTATC C - G A - T G - C C - G A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |