Sequence ID | >WENV171002804 |
Genome ID | NHNJ01174164 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 181 |
End posion on genome | 93 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcatcccttG |
tRNA gene sequence |
GAGGAAATGGCAGAGTGGTCGAATGCGGCAGTCTTGAAAACTGTTGAGGGTCACACCTCC |
Downstream region at tRNA end position |
agacccttgt |
Secondary structure (Cloverleaf model) | >WENV171002804 Ser TGA G GCAA agacccttgt G - C A C G + T G - C A - T A - T A - T T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TGAGGGTCACACCTCC G + T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |