Sequence ID | >WENV171002886 |
Genome ID | NHNJ01199558 |
Phylum/Class | [NHNJ] marine metagenome; surface waters at 20 m depth at the end of the Scripps Institution of Oceanography (SIO) pier |
Species | |
Start position on genome | 455 |
End posion on genome | 546 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tatgtcatat |
tRNA gene sequence |
GGAAGAGTGGGTGAGAGGCTGAAACCAGTCGTTTGCTAAATGACCGTGCGAGGAAACTTG |
Downstream region at tRNA end position |
tcaaaataag |
Secondary structure (Cloverleaf model) | >WENV171002886 Ser GCT t GCCA tcaaaataag G - C G - C A - T A - T G - C A - T G - C T A T C T C C C A A G A G | | | | | G G G T G G G A G G G C G | | | T T C A A C C T G A A CGTGCGAGGAAACTTGTACC G - C T - A C - G G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |