| Sequence ID | >PL191000130 |
| Genome ID | CP009323 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia gladioli ATCC 10248 plasmid: (CP009323) |
| Start position on genome | 1449209 |
| End posion on genome | 1449134 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
cttcttcgtt |
| tRNA gene sequence |
GGCCCGGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGTTGGTTCGATT |
| Downstream region at tRNA end position |
cattcgaaaa |
| Secondary structure (Cloverleaf model) | >PL191000130 Phe GAA
t ACCA cattcgaaaa
G - C
G - C
C - G
C - G
C A
G - C
G - C T T
T C A G C C A
T G A A | | + | | G
T C T C G G T T G G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
C - G
G - C
G - C
A - T
T A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |