| Sequence ID | >PL191000360 |
| Genome ID | CP022789 |
| Phylum/Class | Betaproteobacteria |
| Species | Ralstonia solanacearum SL3175 plasmid:unnamed (CP022789) |
| Start position on genome | 286887 |
| End posion on genome | 286803 |
| Amino Acid | Leu |
| Anticodon | CAG |
| Upstream region at tRNA start position |
ggctcaccta |
| tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCACTAGTTTCAGGTACTAGCGGGTAACTCCGTGGA |
| Downstream region at tRNA end position |
gatttcttcc |
| Secondary structure (Cloverleaf model) | >PL191000360 Leu CAG
a ACCA gatttcttcc
G - C
C - G
C - G
C - G
A - T
G - C
G - C T G
T T C T C C A
T A A G + | | | | G
T G G C G G G A G G C
G | | | T T
G A C G C
T A G A CGGGTAACTCCGT
C - G
T - A
A - T
G - C
T - A
T T
T G
C A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |