| Sequence ID | >PL191000485 |
| Genome ID | CP025986 |
| Phylum/Class | Betaproteobacteria |
| Species | Ralstonia solanacearum RSCM plasmid:p-unname2 (CP025986) |
| Start position on genome | 981075 |
| End posion on genome | 981168 |
| Amino Acid | Ser |
| Anticodon | GCT |
| Upstream region at tRNA start position |
cgctgttttg |
| tRNA gene sequence |
GGAGACGTGGCCGAGAGGTCGAAGGCACTCCCCTGCTAAGGGAGCATCCGGGCCAAAACC |
| Downstream region at tRNA end position |
gtttggcgct |
| Secondary structure (Cloverleaf model) | >PL191000485 Ser GCT
g GCCA gtttggcgct
G - C
G - C
A - T
G - C
A - T
C - G
G - C T A
T C T C C C A
A G A G | | | | | G
G G C C G G A G G G C
G | | | T T
T A G G C
C G A A CATCCGGGCCAAAACCTGGATC
C - G
T - A
C - G
C - G
C - G
C A
T A
G C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |