| Sequence ID | >W141484928 |
| Genome ID | JFYZ01000002 |
| Phylum/Class | Alphaproteobacteria |
| Species | Novosphingobium resinovorum [JFYZ] |
| Start position on genome | 341230 |
| End posion on genome | 341306 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
gccttggtat |
| tRNA gene sequence |
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG |
| Downstream region at tRNA end position |
aggcccatca |
| Secondary structure (Cloverleaf model) | >W141484928 Met CAT
t ACCA aggcccatca
G + T
G - C
C - G
G - C
G - C
A - T
G - C T G
T C T C C C A
T G A A | + | | | G
C C T C G G G G G G C
G | | | | T T
G G A G C
T T A A GTGTC
G - C
C - G
G - C
G - C
A - T
A A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |