The detailed information of tRNA gene sequence


Sequence ID>C181062008
Genome IDCP022316
Search identical group
Phylum/ClassActinobacteria
SpeciesBrachybacterium sp. VR2415 (CP022316)
Start position on genome 1119740
End posion on genome 1119811
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
acagcttttc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCtc
Downstream region at tRNA end position
tgtggtgtct
Secondary structure (Cloverleaf model)
>C181062008	Gly	CCC
                   c      TCtc tgtggtgtct
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK