| Sequence ID | >C181064982 |
| Genome ID | CP022436 |
| Phylum/Class | Actinomycetota |
| Species | Arthrobacter sp. YN [CP022436] |
| Start position on genome | 3186007 |
| End posion on genome | 3185932 |
| Amino Acid | Glu |
| Anticodon | CTC |
| Upstream region at tRNA start position |
aaaagtgcaa |
| tRNA gene sequence |
GGCCCCATCGTATAGCGGCCTAGTACGCTGCCCTCTCACGGCGGTAACGCGGGTTCGAAT |
| Downstream region at tRNA end position |
cagaaatccc |
| Secondary structure (Cloverleaf model) | >C181064982 Glu CTC
a ACCA cagaaatccc
G - C
G + T
C - G
C - G
C - G
C - G
A - T T A
T C G C C C A
C G A C | | | | | G
G T A T G G C G G G C
G + | | | T T
C G T A C
C T A G TAAC
C - G
T + G
G - C
C - G
C - G
C C
T A
C T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |