The detailed information of tRNA gene sequence


Sequence ID>C181082310
Genome IDCP023481
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus glycinifermentans KBN06P03352 (CP023481)
Start position on genome 1885255
End posion on genome 1885183
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tcaaataaac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
tggaaaccct
Secondary structure (Cloverleaf model)
>C181082310	Ala	GGC
                   c      Atct tggaaaccct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK