The detailed information of tRNA gene sequence


Sequence ID>C181084650
Genome IDCP023563
Search identical group
Phylum/ClassActinobacteria
SpeciesBrachybacterium sp. VM2412 (CP023563)
Start position on genome 1342210
End posion on genome 1342139
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
gcagcgcttc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCtt
Downstream region at tRNA end position
tcggacgccg
Secondary structure (Cloverleaf model)
>C181084650	Gly	CCC
                   c      TCtt tcggacgccg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK