The detailed information of tRNA gene sequence


Sequence ID>C181084701
Genome IDCP023564
Search identical group
Phylum/ClassActinobacteria
SpeciesBrachybacterium ginsengisoli DCY80 (CP023564)
Start position on genome 886863
End posion on genome 886792
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
agccgccttc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCtc
Downstream region at tRNA end position
cgagacgccg
Secondary structure (Cloverleaf model)
>C181084701	Gly	CCC
                   c      TCtc cgagacgccg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK