The detailed information of tRNA gene sequence


Sequence ID>C181099811
Genome IDCP024422
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus yeei TT13 (CP024422)
Start position on genome 162868
End posion on genome 162795
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
aagccgggcc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
gttccccacc
Secondary structure (Cloverleaf model)
>C181099811	Gly	CCC
                   c      TCCA gttccccacc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK