The detailed information of tRNA gene sequence


Sequence ID>C181172988
Genome IDCP029049
Search identical group
Phylum/ClassActinobacteria
SpeciesMiniimonas sp. S16 (CP029049)
Start position on genome 2262886
End posion on genome 2262958
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
cggcggcagc
tRNA gene sequence
GCGGGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC
CGTCACCCGCTCCc
Downstream region at tRNA end position
atgagccggt
Secondary structure (Cloverleaf model)
>C181172988	Gly	CCC
                   c      TCCc atgagccggt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T G C C C     A
        A A        A      + | | | |     G
      T     C T T G       G C G G G     C
      G     | | | |                 T T
      G     G A A C
        T A        T     TAGC
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK