The detailed information of tRNA gene sequence


Sequence ID>C181200053
Genome IDCP031413
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesLysobacter sp. TY2-98 (CP031413)
Start position on genome 1736680
End posion on genome 1736756
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ggcggcttgg
tRNA gene sequence
GGCCCCGTAGCTCAGCTGGATAGAGCGTCCCCCTCCTAAGGGGAAGGTCGCACGTTCGAA
TCGTGTCGGGGCCGCCA
Downstream region at tRNA end position
ctggaaccct
Secondary structure (Cloverleaf model)
>C181200053	Arg	CCT
                   g      GCCA ctggaaccct
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     T G T G C     A
      C G A        A      + | | | |     G
    T       C T C G       G C A C G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGTC
                    T - A
                    C - G
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK