The detailed information of tRNA gene sequence


Sequence ID>C181217616
Genome IDLS483499
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesTatumella ptyseos NCTC11468 (LS483499)
Start position on genome 2347261
End posion on genome 2347335
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gcagttttac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
ttccatagtt
Secondary structure (Cloverleaf model)
>C181217616	Arg	CCT
                   c      ACCA ttccatagtt
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK