The detailed information of tRNA gene sequence


Sequence ID>C191073599
Genome IDCP031078
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus yeei CCUG 32053 (CP031078)
Start position on genome 2157334
End posion on genome 2157261
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
aagccgggcc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
gttccccacc
Secondary structure (Cloverleaf model)
>C191073599	Gly	CCC
                   c      TCCA gttccccacc
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK