The detailed information of tRNA gene sequence


Sequence ID>C191111784
Genome IDCP033780
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesCitrobacter koseri FDAARGOS_530 (CP033780)
Start position on genome 2655734
End posion on genome 2655660
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gtgccgcctc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tacatacctc
Secondary structure (Cloverleaf model)
>C191111784	Arg	CCT
                   c      ACCA tacatacctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK