The detailed information of tRNA gene sequence


Sequence ID>C191134132
Genome IDCP035034
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea ananatis NN08200 (CP035034)
Start position on genome 1555037
End posion on genome 1554963
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ctgcgctggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tatgttagcc
Secondary structure (Cloverleaf model)
>C191134132	Arg	CCT
                   c      ACCA tatgttagcc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK