The detailed information of tRNA gene sequence


Sequence ID>C191134363
Genome IDCP035090
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans ATCC 19367 (CP035090, CP035091)
Start position on genome 237861
End posion on genome 237944
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
gcgcagaaag
tRNA gene sequence
GCCCGAGTGGCGGAATGGTAGACGCAGCGGATTCAAAATCCGCCGCCGCAAGGCATGTCG
GTTCGAGTCCGACCTCGGGTACCA
Downstream region at tRNA end position
aatcctggtg
Secondary structure (Cloverleaf model)
>C191134363	Leu	CAA
                   g      ACCA aatcctggtg
                     G + T
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C          T G
                    T     C A G C C     A
      T A A        G      | | | | |     G
    G       G G C G       G T C G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     CGCCGCAAGGCAT
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  T       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK