The detailed information of tRNA gene sequence


Sequence ID>C191134371
Genome IDCP035090
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans ATCC 19367 (CP035090, CP035091)
Start position on genome 798451
End posion on genome 798536
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
caatcccggc
tRNA gene sequence
GCGGGCGTGGCGGAATGGTAGACGCATGGGACTTAAACTCCCTGGGGCGCAAGCCTGTGC
GGGTTCGAGTCCCGCCGCCCGCACCA
Downstream region at tRNA end position
atatttccag
Secondary structure (Cloverleaf model)
>C191134371	Leu	TAA
                   c      ACCA atatttccag
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     C G C C C     A
      T A A        G      | | | | |     G
    G       G G C G       G C G G G     C
    G         | | |                 T T
    T       A C G C
      A G          A     GGGGCGCAAGCCTGT
                    T   T
                    G - C
                    G - C
                    G - C
                    A - T
                  C       C
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK