The detailed information of tRNA gene sequence


Sequence ID>C191134402
Genome IDCP035090
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans ATCC 19367 (CP035090, CP035091)
Start position on genome 513055
End posion on genome 512982
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tccgggcctc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
gcctttcccg
Secondary structure (Cloverleaf model)
>C191134402	Gly	CCC
                   c      TCCA gcctttcccg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK