The detailed information of tRNA gene sequence


Sequence ID>C191137754
Genome IDCP035232
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus glycinifermentans SRCM103574 (CP035232)
Start position on genome 3566103
End posion on genome 3566031
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tcaaacaaac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
cgggaaccct
Secondary structure (Cloverleaf model)
>C191137754	Ala	GGC
                   c      Atct cgggaaccct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK