The detailed information of tRNA gene sequence


Sequence ID>C191146949
Genome IDCP035914
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8101 (CP035914)
Start position on genome 493539
End posion on genome 493612
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
cttggaacgT
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGTtt
Downstream region at tRNA end position
tttcgatgat
Secondary structure (Cloverleaf model)
>C191146949	Gln	TTG
                   T      GTtt tttcgatgat
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK