The detailed information of tRNA gene sequence


Sequence ID>C191146972
Genome IDCP035914
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8101 (CP035914)
Start position on genome 2234976
End posion on genome 2234895
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
cgtcagccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttcacaa
Secondary structure (Cloverleaf model)
>C191146972	Leu	GAG
                   c      Attt ctcttcacaa
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK