The detailed information of tRNA gene sequence


Sequence ID>C191146984
Genome IDCP035914
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8101 (CP035914)
Start position on genome 471433
End posion on genome 471343
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
tggcgccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtg
Downstream region at tRNA end position
aattaaatcg
Secondary structure (Cloverleaf model)
>C191146984	Ser	GCT
                   T      GTtg aattaaatcg
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK