The detailed information of tRNA gene sequence


Sequence ID>C191151691
Genome IDCP036487
Search identical group
Phylum/ClassFirmicutes
SpeciesThermoactinomyces vulgaris CDF (CP036487)
Start position on genome 1211727
End posion on genome 1211652
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tgaaaaacac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
aaggaaaacc
Secondary structure (Cloverleaf model)
>C191151691	Ala	GGC
                   c      ACCA aaggaaaacc
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK