The detailed information of tRNA gene sequence


Sequence ID>W141532255
Genome IDJHET01000006
Search identical group
Phylum/ClassActinobacteria
SpeciesMicrobacterium sp. CH12i [JHET]
Start position on genome 81178
End posion on genome 81250
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
ggttctgcca
tRNA gene sequence
GCCTCTGTAGCTCAATGGAAGAGCAGTTCCGTCCTAAGGAAAGGGTTGGGGGTTCGACTC
CCTCCAGGGGCACtc
Downstream region at tRNA end position
ataggaatta
Secondary structure (Cloverleaf model)
>W141532255	Arg	CCT
                   a      ACtc ataggaatta
                     G - C
                     C - G
                     C - G
                     T + G
                     C - G
                     T - A
                     G - C          T C
                    T     C T C C C     A
        A A        A      | + | | |     G
      T     C T C G       G G G G G     C
      G     | | | |                 T T
      G     G A G C
        A A        A     GGGTT
                    G   A
                    T - A
                    T - A
                    C - G
                    C - G
                  G       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK