| Sequence ID | >C191163752 |
| Genome ID | CP039249 |
| Phylum/Class | Alphaproteobacteria |
| Species | Sphingomonas sp. PAMC26645 [CP039249] |
| Start position on genome | 3340146 |
| End posion on genome | 3340222 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
gccagccgat |
| tRNA gene sequence |
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA |
| Downstream region at tRNA end position |
gcttttccgc |
| Secondary structure (Cloverleaf model) | >C191163752 Arg CCT
t ACCA gcttttccgc
G - C
C - G
C - G
C - G
C - G
C - G
G - C T A
T C G C T C A
C G A A | | | | A
C C T C G G C G T G C
G | | | | T T
G G A G C
A T A G AGGCC
A - T
C - G
G - C
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |