The detailed information of tRNA gene sequence


Sequence ID>C191165426
Genome IDCP039373
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. CB0101 (CP039373)
Start position on genome 2018563
End posion on genome 2018653
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gcgagccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtt
Downstream region at tRNA end position
taaacgatct
Secondary structure (Cloverleaf model)
>C191165426	Ser	GCT
                   T      GTtt taaacgatct
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK