The detailed information of tRNA gene sequence


Sequence ID>C191165447
Genome IDCP039373
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. CB0101 (CP039373)
Start position on genome 1996288
End posion on genome 1996215
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
agcgactcgT
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGTtt
Downstream region at tRNA end position
tcagagcttc
Secondary structure (Cloverleaf model)
>C191165447	Gln	TTG
                   T      GTtt tcagagcttc
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK