The detailed information of tRNA gene sequence


Sequence ID>C191175014
Genome IDCP040095
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPantoea sp. SO10 (CP040095)
Start position on genome 2932977
End posion on genome 2933051
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgcccggc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
gattttcatc
Secondary structure (Cloverleaf model)
>C191175014	Arg	CCT
                   c      ACCA gattttcatc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK