The detailed information of tRNA gene sequence


Sequence ID>C191199857
Genome IDLR134204
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesCitrobacter koseri NCTC11075 (LR134204)
Start position on genome 1002127
End posion on genome 1002201
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gtgccgcctc
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
tacatacctc
Secondary structure (Cloverleaf model)
>C191199857	Arg	CCT
                   c      ACCA tacatacctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK