The detailed information of tRNA gene sequence


Sequence ID>C191210356
Genome IDLR134392
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus licheniformis NCTC10341 (LR134392)
Start position on genome 3148888
End posion on genome 3148816
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
tcaaatatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
ttaaaaccct
Secondary structure (Cloverleaf model)
>C191210356	Ala	GGC
                   c      Atct ttaaaaccct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK