The detailed information of tRNA gene sequence


Sequence ID>C191221568
Genome IDLR590470
Search identical group
Phylum/ClassBacteroidetes
SpeciesSphingobacterium daejeonense NCTC13534 (LR590470)
Start position on genome 2970806
End posion on genome 2970730
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
gagataagct
tRNA gene sequence
AGTCCCGTAGCTCAGTTGGTTAGAGCACTACACTGATAATGTAGGGGTCAGCAGTTCAAG
TCTGCTCGGGACTACCA
Downstream region at tRNA end position
ccgcggggaa
Secondary structure (Cloverleaf model)
>C191221568	Ile	GAT
                   t      ACCA ccgcggggaa
                     A - T
                     G - C
                     T - A
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     T C G T C     A
      T G A        A      | | | | |     A
    T       C T C G       A G C A G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK