The detailed information of tRNA gene sequence


Sequence ID>W09103372
Genome IDAAJD01000015
Search identical group
Phylum/ClassChlorobi
SpeciesProsthecochloris vibrioformis DSM 265 [AAJD]
Start position on genome 11248
End posion on genome 11321
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
tctcttcaat
tRNA gene sequence
GGACAGATAGCTCAGTTGGTAGAGCAATGGACTGAAAATCCATGTGTCGTGGGTTCGATT
CCCTCTCTGTCCACtt
Downstream region at tRNA end position
cttcgtcgtt
Secondary structure (Cloverleaf model)
>W09103372	Phe	GAA
                   t      ACtt cttcgtcgtt
                     G - C
                     G - C
                     A - T
                     C - G
                     A - T
                     G - C
                     A - T          T T
                    T     C T C C C     A
      T G A        A      |   | | |     G
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GTGTC
                    A - T
                    T - A
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK