The detailed information of tRNA gene sequence


Sequence ID>W09102664
Genome IDAAIB01000021
Search identical group
Phylum/ClassChlorobi
SpeciesChlorobium phaeobacteroides DSM 266 [AAIB]
Start position on genome 7696
End posion on genome 7780
Amino Acid Leu
Anticodon CAG
Upstream region at tRNA start position
ataacgcaat
tRNA gene sequence
GCCCGAATGGCGGAACTGGTAGACGCACTCGTTTCAGGGACGAGCGCCGCAAGGTGTAGG
AGTTCGAATCTCCTTTCGGGCACCA
Downstream region at tRNA end position
ataatcttct
Secondary structure (Cloverleaf model)
>W09102664	Leu	CAG
                   t      ACCA ataatcttct
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     A - T
                     A - T          T A
                    T     T C C T C     A
      C A A        G      | | | | |     G
    T       G G C G       A G G A G     C
    G         | | |                 T T
    G       A C G C
      T A G        A     CGCCGCAAGGTGT
                    C - G
                    T - A
                    C - G
                    G - C
                    T - A
                  T       G
                  T       G
                    C A G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK