The detailed information of tRNA gene sequence


Sequence ID>W141812378
Genome IDJQDQ01000050
Search identical group
Phylum/ClassDeltaproteobacteria
SpeciesSmithella sp. SCADC [JQDQ]
Start position on genome 5365
End posion on genome 5439
Amino Acid Val
Anticodon CAC
Upstream region at tRNA start position
aacgtcactt
tRNA gene sequence
GGGCGGTTAACTCAGCGGGAGAGTGCTACCTTCACACGGTAGAAGTCACTGGTTCAAATC
CAGTACCGCCTACCA
Downstream region at tRNA end position
tttatttcaa
Secondary structure (Cloverleaf model)
>W141812378	Val	CAC
                   t      ACCA tttatttcaa
                     G + T
                     G - C
                     G - C
                     C - G
                     G - C
                     G - C
                     T - A          T A
                    T     T G A C C     A
        G A        A      | | | | |     A
      C     C T C A       A C T G G     C
      G     | | | |                 T T
      G     G A G T
        G A        G     AAGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    C - G
                  T       C
                  T       A
                    C A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK