The detailed information of tRNA gene sequence


Sequence ID>W1930018413
Genome IDMNVZ01000010
Search identical group
Phylum/ClassCandidatusPacearchaeota
SpeciesCandidatus Pacearchaeota archaeon CG1_02_39_14 (MNVZ)
Start position on genome 32314
End posion on genome 32241
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
tctttttatT
tRNA gene sequence
GGGCCCATAGTTTAATGGATAGAATGTCAGGCCTCGGACCTGAAGATAGGGGTTCAATTC
CTCTTGGGCCCATaa
Downstream region at tRNA end position
gaaaaatgag
Secondary structure (Cloverleaf model)
>W1930018413	Arg	TCG
                   T      ATaa gaaaaatgag
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     A - T          T T
                    T     T C T C C     A
      T A A        A      | | + | |     A
    G       T T T G       A G G G G     C
    G       + | | +                 T T
    A       G A A T
      T A          G     AGAT
                    T - A
                    C - G
                    A - T
                    G - C
                    G - C
                  C       A
                  C       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK